Friday, September 4, 2020

Unequal Charges in Australia for International Students

Question: Talk about the Unequal Charges in Australia for International Students. Answer: Presentation The youthful age grasps the fate of our general public, their accomplishments and disappointments will inevitably figure out which course the advancement of human culture is going to take. It ought not stay away from notice that the destiny of an age lies on the instruction and preparing the age gets. Instruction is an essential platform of our lives, without which we can't arrive at the zenith of accomplishment. Instruction not just gives us information and mastery over our picked classification, it gives us knowledge, behavior and regard. Instruction gives us an abundance of chances that guides us in proficient just as self-awareness; consequently every single kid in this world has an option to training (Zhang, Worthington and Hu 2016). Anyway there are a great deal of denied and immature nations in our reality that come up short on the best foundation and open doors for different controls of understudies. Definitely a large number of hopeful understudies move to various nations trying to pursue their fantasies of a prosperous vocation (Norton and Cakitaki 2016). Australia is one of the multicultural center points with a horde of chances for understudies of different orders. Australia is equipped with around 43 unique colleges and different other instructive foundations that give one of a class instructive involvement in a bunch obviously alternatives to browse for the understudies. Normally a large number of understudies move to Australia in the desires for finding their specialty in the domain of instruction and vocation (Nicol, Thomson and Breslin 2014). Studies propose that right around 33% of the whole understudies moved on from Australia are remote understudies, and still Australian instructive board charges this enormous populace of worldwide understudies about 400 percent more than what they charge their home understudies (Australia 2013). As per the information from Australian Government Higher Education Statistics, around 300 thousand understudies graduated in the time of 2012 from Australian colleges, out of which 100 thousand were universal ones. Contentions can be raised on what is pulling in this immense inundation of remote understudies regardless of the out of this world instructive cost. The promoting brief of the colleges can give knowledge to address the contention without any problem. With the alluring and influential PR articulations of Universities of Queensland, Sydney or Melbourne, their accentuation is on what sensational instructive open doors they are giving and what incredible a future the understudies can ac hieve while being related with these eminent colleges, anyway the fact of the matter is totally unique (Abc.net.au. 2017). The universal understudies regardless of being tricked in are seldom rewarded in the same class as they by and large guaranteed. As per the eminent neuroscientist Peter Osborne, the tremendous imbalance in the instructive expenses among local and universal understudies isn't because of rising charges as one would by and large expect, however is because of implementation of national benefit (Altbach 2015). Studies propose that the universal understudies are charged $35,500 every year for seeking after an essential science qualification where a similar degree costs just $8,500 per annum to an Australian understudy. Eyes can be raised on the lawful prospects of such a grand distinction in instructive charges in abroad and local understudies, yet concurring Australian customer law, an owner is permitted to set the costs as per their terms and conditions as long as the determination measures and evaluating is pervasively and noticeably showed. Thus the abroad understudies being exposed to indecent estimating is lawfully right as per Australian laws, yet is it ethically right (Abc.net.au. 2017). The clarifications from the Australian training board is that the abroad understudies are charged more than the local understudies since they don't make good on charges, however this announcement can't be all the more off-base. As a matter of first importance, the world positioning Australian colleges that are charging abroad understudies a fortune for a degree are settled and monetarily secure. Besides, it must be viewed as that the abroad understudies pay assessments to enter Australia, and from there on everything. They are charged duties for lodging, purchasing anything and winning also, subsequently the assessments are not the issue here (Norton and Cakitaki 2016). As per the United Nations human rights sanction instruction is one of the most fundamental human rights. Anyway the abroad understudies are compelled to buy the option to great training like some ware with a strong bill, while a portion of the Asian nations are setting a model by charging the abroad understudies equivalent to residential ones. Opportunity has arrived to assess these separations and improper requirement of national benefits to discover a future for our general public where the understudies, paying little mind to their citizenships, are treated with value and are give equivalent rights to quality training. References: Abc.net.au. (2017). ABC - Australian Broadcasting Corporation. [online] Available at: https://www.abc.net.au [Accessed 18 Apr. 2017]. Altbach, P., 2015. Points of view on internationalizing advanced education. Worldwide Higher Education, (27). Australia, U., 2013. A plan for Australian advanced education 2013-2016: A more brilliant Australia. Nicol, D., Thomson, A. what's more, Breslin, C., 2014. Reexamining input rehearses in advanced education: a companion audit point of view. Appraisal Evaluation in Higher Education, 39(1), pp.102-122. Norton, A. what's more, Cakitaki, B., 2016. Mapping Australian advanced education 2016. Grattan Institute. Zhang, L.C., Worthington, A.C. what's more, Hu, M., 2016. Cost economies in the arrangement of advanced education for worldwide understudies: Australian proof. Advanced education, pp.1-18.

Tuesday, August 25, 2020

Globalisation ; Video games

I am sitting in a little coffeehouse on Nanjing Road in the core of Shanghai's focal business area as I compose this post. As I check out me the vitality of this city is substantial. There is a feeling of idealism and a can-do disposition that is surprisingly like what I involvement with each energetic economy around the world. There is another ongoing theme. Gaming is inescapable. Any place I look, regardless of whether in the café or in the tram or bus stop, individuals are getting a charge out of computer games and submerged in their telephone, tablet, or laptop.Last week, I explained the first of three mainstream orces that I accept are changing the videogame business and today appears to be more pertinent than any time in recent memory to talk about the subsequent one: globalization. The worldwide programming market for computer games was around $52 billion of every 2012. In Just the most recent 8 years, the developing markets have gone from 12% to 47% of the market size and ar e developing at an exacerbated yearly pace of almost 30%. While the development is wide based, nations like China, Brazil and Russia are on a tear, developing as much as 100% in classifications like Android and iOS.In a large portion of these business sectors, comforts are an extremely little craft of gaming today, however that is likewise beginning to change as even nations like China are reexamining since a long time ago held arrangements on permitting supports. As I take a gander at innovative and game play patterns, it is my solid conviction that the market for gaming will continue this development for a long time to come and as a rule even quicken. Notwithstanding, with globalization comes an altogether different arrangement of specialized difficulties. Organizations can't just imitate their achievement in western markets with a â€Å"rinse and repeat† of existing procedures for new geographies.Companies that basically ranslate their items verbatim and discharge it into new markets will fizzle. To succeed, you need to think worldwide however act nearby. I don't get this' meaning with regards to videogames? Every nation is distinctive in its gaming designs, purchaser conduct, foundation, business standards and neighborhood guidelines. Various parts of the game must be custom-made for nearby playing conditions just as the game was developed from the beginning that market.A hardly any models: New game substance that has neighborhood pertinence and offer Architectural changes that take into account nearby framework, for example, representing expected system latencies and parcel misfortunes. Presentation of various plans of action, for example, allowed to-play Respect for neighborhood business standards, for example, Konbini in Japan or Boleto Bancario in Brazil Expansion of the backend stage to help nearby offers, advancements and evaluating changes Even however videogames are common around the globe today, there are social subtleties that are critical to respond to with regards to conveying computerized diversion and services.It's not Just about promoting items in an unexpected way (which is likewise significant) yet the innovation spine that goes into supporting these titles additionally needs to modify for he nation or area you're in. Everything from installment frameworks, ongoing interaction mechanics and adaptation systems could be unique. One such model is Plants versus Zombies, an astounding pinnacle resistance game from PopCap that has a monstrous purchaser base in North America.It has had exceptional achievement in China with its Great Wall version which was discharged on versatile in China with nearby substance, customer information plans (26 and 36) and neighborhood arrange topology. Another model is FIFA Online 3 which was as of late discharged in Korea and depends on the game mechanics of the famous FIFA 13 reassure game however custom fitted for the neighborhood showcase. It has just broken records with 2. 4 millio n players in Just the initial a month since launch.It's an arrangement that works better for that market and offers us the chance to convey one of our center establishments to another crowd. Worldwide availability has extended the open doors for our industry while additionally totally changing the requests on our innovation framework. I must think worldwide with each choice I make. My next post I'll address what I see as the last common power †social availability. Meanwhile, I'd love to hear how going worldwide in business impacts your everyday.

Saturday, August 22, 2020

3 QUESTIONS IN CRIMINAL JUSTICE and deviance Coursework - 1

3 QUESTIONS IN CRIMINAL JUSTICE and aberrance - Coursework Example Ermann and Lundman (1982) additionally offer a few recommendations on the best way to diminish events of corporate abnormality, for example, â€Å"changes in corporate sanctioning, the insurance of informants, and the discipline of officials associated with corporate criminality.† All these suggestions must be taken together and joined with more noteworthy watchfulness from the general population. This incorporates guaranteeing that corporate miscreants realize that their activities won't go unpunished. Truly, I think there are consistent themes obvious in the four articles in the book by Thio, Calhoun and Conyers (2008.) One clear evident shared characteristic is that it exhibits that individuals who are survivors of viciousness don't generally respond to brutality in the manner that others may think to be commonsensical. Rather than programmed opposing or extreme aversion of the abuser, we see an intricate blend of pity, self-fault, blame, sentiments of vulnerability, and this is valid for moms who are survivors of their children’s brutality (Jackson, 98), stalkers from past connections (Dunn, 94) and battered spouses (Bates, 89). This is likewise valid for survivors of avoidance who at that point ended up as sexual molesters (Lawson, 108.) Also, these articles exhibit that inspirations for perpetrating violations are progressively entangled that we think and have mental inspirations. Akers and Sellers (2004) depicted mental hypothesis as one wherein the comprehension of wr ongdoing can be followed back to a hidden character or mental issue. 3. Are there identifiers noticeable that would show potential foolish aberrance? Provided that this is true, what are they and what should be possible once watched? If not, what should be possible to endeavor to recognize pointers of future foolish conduct? Indeed, the exploration in the field of foolish abnormality have given some potential markers of self-destructive propensities, in spite of the fact that the examination rushes to call attention to that

International Context of HRM Practice and Consultancy Essay

Global Context of HRM Practice and Consultancy - Essay Example 12 References 13 Work Councils †Functions and Difference from Trade Unions Globalization has activated ocean changes in the transnational business as well as deluged with issues concerning work relations in a culturally diverse and multi-monetary situation. The prior idea of haggling with a focal worker's organization and executing the issues settled upon in work environment is not, at this point an adequate assurance of smooth work relations. Global ventures currently need to haggle at numerous levels with worker's guilds of a few nations to accomplish agreeable work relations. This clearly is a humongous assignment what with managing in unionized work of various social and financial settings (Prahalad and Doz 1987). Such circumstances most likely outcome in loss of administrative adaptability as conditions settled upon in one nation probably won't be worthy in another nation. Further, the terms and states of arrangement and related compensations and perquisites likewise fluctu ate from nation to nation hence causing unwanted differences in overseeing HR. The essential issue of transnational human asset the executives can be classified as (Poole 1986): The degree of mechanical accomplishment and unionization of work in a specific nation The nature and degree of administrative intercession in labor the executives The number and political polarization of worker's organizations Impact, assuming any, of strict associations on worker's guilds Strategies received by the board These elements have brought about the development and expansion of different sorts of worker's guilds which could be either summed up worker's guilds that spoke to all classifications of representatives, or, art associations that spoke to workers having explicit ranges of abilities and are utilized in various enterprises, or, a combination of associations spread across various nations. Such decent variety, clearly, present a somewhat overwhelming situation for officials endowed with the obl igation of aggregate dealing with representatives and furthermore raises the possibility of different understandings inside a solitary corporate element. One choice open to global companies to discover some similarity to arrange in this in any case tumultuous and uncertain situation is to set up work chambers. These are miniaturized scale level work delegates who are chosen by laborers of a particular manufacturing plant for a time of four years. The most energetic types of such work chambers are seen in Germany where once across the nation concurrences with perceived worker's organizations are finished by agents of a specific industry, every individual part firm of that specific industry attempt exchanges with their separate work committees on the subtleties of how such an understanding must be executed in a specific work place. As individuals from work gatherings need not be individuals from perceived worker's guilds, these chambers can be shaped even in those ventures where there is no presence of a broadly perceived worker's organization. This most likely puts resources into such chambers a huge level of adaptability and opportunity from authoritative opinion or political impact related with traditional worker's organizations. This likewise gives a chance to both administration and laborers to reach out an accord that factors in small scale points of interest and subsequently is gainful to both the laborers and that specific firm. The other advantage of having work chambers is that the degrees of collaboration and the channels of correspondence among the executives and wo

Friday, August 21, 2020

Information Technology Essay

Progressions in data innovation have had numerous incredible advantages on society. It has upset the period of business and living far and wide. Data Technology has caused Local organizations to get global because of a straightforward site. Data innovation (IT) is the utilization of PCs and broadcast communications hardware to store, recover, transmit and control information. The term is regularly utilized as an equivalent word for PCs and PC systems, however it additionally envelops other data appropriation innovations, for example, TV and phones. It is comprehensively considered to incorporate the utilization of PCs and broadcast communications hardware to store, recover, transmit and control information. A few enterprises are related with data innovation, for example, PC hardware,software, gadgets, semiconductors, web, telecom gear and PC administrations (Chandler, 2012). Hence, the motivation behind this task is to talk about the miracles and abhorrences Information Technology has brought to us. It will initially take a gander at the miracles which Information Technology has brought, and afterward it will take a gander at the abhorrences. It is from the miracles and repulsions were an end will be drawn from. Today data innovation includes something other than PC proficiency; it likewise considers how PCs work and how these PCs can additionally be utilized for data handling as well as for interchanges and critical thinking assignments too. Data innovation additionally includes the turn of events, establishment, execution, support, and the utilization of PC frameworks, programming and systems for the preparing and circulation of information (Daintith, 2009). Our present reality has changed a lot with the guide of data innovation. The transformation in IT has itself been delivered by an organization of advancements in broadcast communications and informatics, made conceivable by less expensive new lightweight materials, for example, optical filaments transmitting data quicker. Data streams quicker and less lavishly all through the globe, however it will set aside generous effort to arrive at full digitalization given its young people (Achimugu et al; 2009). Things that were once done physically or by hand have now become modernized working frameworks, which just require a solitary snap of a mouse to get an assignment finished. With the guide of Information Technology, we are not just ready to smooth out our business forms yet we are likewise ready to get consistent data in ‘real time’ that is up to the moment and forward-thinking (Vermaat,2004). The noteworthiness of Information Technology can be seen from the way that it has infiltrated pretty much every part of our day by day lives from business to recreation and even society. The world has an expected 350 million web clients. Over 90% of them are in mechanical nations, albeit creating nations involve about 85% of the total populace (Berndt and Morrison, 1995). Today PCs, PDAs, fax machines, email and web have all not just become an indispensable piece of our very culture yet in addition assume a fundamental job in our everyday exercises (Parker, 2003). Data Technology has gotten a great deal of marvels our day by day living. A portion of the marvels include: Globalization †IT has united the world, however it has permitted the world’s economy to turn into a solitary related framework. This implies we can share data rapidly and effectively, however we can likewise cut down obstructions of phonetic and geographic limits. The world has formed into a worldwide town because of the assistance of data innovation permitting nations like Chile and Japan who are isolated by separation as well as by language to shares thoughts and data with one another. Correspondence †With the assistance of data innovation, correspondence has likewise gotten less expensive, speedier, and increasingly productive. We would now be able to speak with anybody around the world by basically message informing them or sending them an email for a practically quick reaction. The web has likewise opened up close and personal direct correspondence from various pieces of the world gratitude to the aides of video conferencing. Data Technology influences the manner in which organizations convey and set up relations with their customers. In the quick moving and business condition, it is crucial for them to interface with customers consistently and rapidly to pick up their trust and to get client steadfastness. With the utilization of web and interpersonal organizations, firms collaborate with buyers and answer every one of their questions about the items. Take for example ‘ Barack Obama-USA President’ as the figure. With the utilization of systems administration locales, for example, Twitter and Facebook, websites, social bookmarking, the pioneer could way to deal with the world at whatever point fundamental and the world can get the news and updates which he has done or needs done inside a brief timeframe. Cost adequacy †Information innovation has assisted with automating the business procedure consequently smoothing out organizations to make them incredibly financially savvy lucrative machines. This thusly expands efficiency which eventually offers ascend to benefits that implies better compensation and less arduous working conditions. Furthermore, to think and to explore, we need assets to discover what our past individuals has thought, what cites they have left for us that is data and hypothesis. Data would now be able to be effortlessly found by a solitary snap in web search tools, for example, Google and yippee. Business Operations. With the utilization of mechanical advancements, entrepreneurs and business person comprehend their income better, how to deal with their capacity costs well and empowers you to set aside time and cash. Connecting the social hole †Information innovation has assisted with crossing over the social hole by helping individuals from various societies to speak with each other, and take into account the trading of perspectives and thoughts, consequently expanding mindfulness and diminishing bias. Additional time †IT has made it workable for organizations to be open 24 x7 everywhere throughout the globe. This implies a business can be open whenever anyplace, making buys from various nations simpler and progressively advantageous. It likewise implies that you can have your merchandise conveyed right to your doorstep with moving a solitary muscle. Increment the feeling of Human Rights-The innovation can help to remember our human rights, essential needs and give refreshes where alleviation or overall assistance is vital. During seismic tremors, horrendous floods, while co-activity is important the World Wide Web can assist us with collecting the gift by an ideal sum. It is preposterous to simply make sense of everything about the great and awful sides of Information and Technology inside a page and article as in light of the fact that it has blended in with each angle and corners of our lives. Or maybe, let us take a gander at the reactions, terrible sides (cons) which IT-parts have brought to the Human Society Creation of new openings †Probably the best bit of leeway of data innovation is the formation of new and intriguing employments. Software engineers, Systems analyzers, Hardware and Software engineers and Web originators are only some f the numerous new work open doors made with its assistance. Data innovations of different sorts, together with globalization, are effectively influencing the scope of work choices for people in cutting edge and creating nations the same and at different degrees of instruction. Further, the classes of Information Technology that robotize, disinter intercede and lessen expenses of remoteness are additional ly empowering the development of progressively mind boggling and topographically different worldwide gracefully chains and systems (Spence, 2012) . Progressions in data innovation have had numerous extraordinary advantages on society; be that as it may, this has not come without its drawbacks. The following are a portion of the abhorrences or drawbacks of data innovation: Unemployment †While data innovation may have smoothed out the business procedure it has additionally made employment redundancies, cutting back and redistributing. This implies a ton of lower and center level employments have been discarded making more individuals become jobless. Innovation in an association, organization or business, the quantity of hours that a human works at that organization is diminished. Innovation is assuming different jobs. The substitution of routine manual work by machines and robots is a ground-breaking, proceeding and maybe quickening pattern in assembling and coordinations, while systems of PCs are supplanting routine cubicle employments in data handling. For example, the disposal of go-betweens in banking, online retail and a large group of taxpayer supported organizations, to give some examples influenced zones. This has even brought about certain individuals losing their positions since innovation is doing it for them. Anyway this is advantageous for the association as their benefit is expanded on the grounds that they don't have to pay their laborers as much since they are not required so a lot (Spence, 2012). Security †Though data innovation may have made correspondence faster, simpler and increasingly helpful, it has additionally purchased along protection issues. From wireless sign block attempts to email hacking, individuals are presently stressed over their once private data turning out to be open information. As IT Sectors have wined the people’s heart around the world. Individuals are here to share and store any sort of data, private date in their hard drives and private online databases. However, because of some Cyber-Criminals, nothing is so protected both on the web and disconnected. In the event that somebody turns into somewhat reckless, the individual may necessities to pay high for it particularly with regards to business related data (Saldarini and DeRobertis, 2003). Absence of professional stability †Industry specialists accept that the web has made employer stability a major issue as since innovation continues changing with every day. This implies one must be in a steady

Saturday, August 8, 2020

Are Students Becoming Too Reliant on Technology

Are Students Becoming Too Reliant on Technology The OE Blog The internet has been hailed as one of the greatest inventions of the modern age; a magical gateway to information, communication and resources unlike anything we could previously have dreamed of. Many have claimed that it is the greatest single technological advance for education, as it opens up opportunities for studying, discovering and learning that were hitherto unimaginable. But as time goes by and the first generation of students to truly grow up with modern internet technology from birth reach their teenage years, some have started to question whether students’ over-reliance on technology could be more of a burden than a blessing… Research The internet provides students with the enormous advantage of a world of information at their fingertips. The simple act of tapping a search term into a keyboard can deliver a Google-selected list of hundreds of relevant articles in under a second â€" a far cry from the hours students would spend leafing through library books and journals in days gone by. But with the internet’s ease of access come disadvantages too â€" false and inaccurate information is easily disseminated and it can be difficult to accurately trace sources or corroborate information. Meanwhile, the sheer volume of research materials online can make it ‘too easy’ for students to find the information they need, allowing them to compile an entire roster of facts by copying and pasting without actually having to understand or analyse the information they are sifting through at all. Whilst a student twenty years ago would have had to read and digest a huge amount of information in order to put together a report on tree frogs, for example, using different sources for different parts of the project, a modern student would be able to discover everything they needed to know from a single internet site, picking up little knowledge in the process. Communication With the rise and rise of fantastic technological solutions for communication, from mobile phones to iPads to Skype and Facebook, a wealth of education opportunities have become available to modern students. Pupils from UK secondary schools can now hold online debates with a class of their contemporaries in the United States or beyond, whilst projects like class blogs, interactive group webpages and programs to design interactive online animations have allowed educational communication to blossom. But at the same time, some argue that the over-reliance of modern teenagers on technology and devices such as mobile phones and laptops is taking its toll in other areas of education. Literacy and writing skills are said to be suffering as children write less and less longhand and text message expressions take precedence over traditional grammar. Simple communication skills and vital understanding of personal interaction are also said to be suffering, as young people spend increasing amounts of time online and communicate using their keyboards rather than face-to-face. Reliance on such methods of communication could be deeply detrimental to their ability to form healthy relationships with others in the long-run, concerned critics say, whilst they also open up dangerous possibilities of cyber-bullying and the persecution of young people online. Plagiarism Another major flaw of teenagers’ over-reliance on modern technology is the ease with which students are able to plagiarise others’ work, whether intentionally or even without realising it. The more students come to rely on Wikipedia and Google to answer their homework questions, the less they are required to use their own minds to come up with independent thoughts and opinions. Instead, they are able to simply click, copy and paste. The Solution? It is clearly facetious to suggest the abandonment of technology in education, as the wealth of opportunities it provides to students is undeniable. But perhaps as we teach our children to use their electronic devices and internet access to learn and discover, we should also concentrate on encouraging them to develop as far as possible in other arenas too. E-communication is a fantastic resource but it should not be a substitute for face-to-face interaction and time spent outside with friends. Online research is an invaluable tool, but should be complimented by studying in libraries and reading books as well. And interactive learning and online teaching can be brilliant experiences, but they must not replace the vital dialogue and bond between teacher and pupil. By ensuring that our students remain educated in interpersonal and ‘real-world’ skills as well as electronic know-how, we can best prepare them to make the most of the opportunities technology has to offer without sufferi ng any of the potentially detrimental consequences.

Tuesday, June 23, 2020

Prostate Cancer Stem Cells

Characterisation of prostate cancer stem cells Abstract Background Advances in the study of cancer cells with stem cell characteristics may enable the development of new and improved cancer therapies. Stem cell marker expression can be investigated by QPCR and this sensitive method has been used to characterise prostate cancer stem cells. Methods Prostate cancer cell lines LNCaP and C42B were grown under adherent and nonadherent culture conditions. Non-adherent culture generated prostaspheres that are enriched in stem cells. In addition, LNCaP and C42B prostaspheres were treated with Wnt3a. RNA was extracted from both adherent and prostasphere cultures of LNCaP and C42B cells. cDNA was synthesized and QPCR analysis was performed with TaqMan probes in order to examine the expression of 10 genes: Nestin, Oct4, Sca-1, BMI-1, PSA, NSE,CD44, K18, ABCG2 and c-kit. Results Prostasphere culture caused a dramatic increase in the relative expression of ABCG2 and Keratin 18 in both cell types. Conclusion The findings suggest ABCG2 may be a valuable marker for identification of prostate cancer cells with stem cell characteristics. Moreover this technique of Q-PCR may prove to be a sensitive method of evaluating markers in cancer patients. Introduction Prostate cancer is commonly diagnosed in males over 60 and is the second most common cause of cancer death in UK in men, after lung cancer (1). Following diagnosis, prostate cancer is categorised in low risk, intermediate risk and high risk. For low risk cases treatment is usually under active surveillance while intermediate and high risk is treated by surgery and radiation. Advanced cases (presence of metastasis) treatment is by androgen ablation and it almost always produces objective clinical responses (2). However, in most patients there is relapse with the development of androgen independent prostate cancer, which is associated with a median survival, of 2024 months (3). Currently, androgen independent metastatic prostate cancer is treated by Docetaxel an anti-mitotic that extends life by an average of 3 months (3). Although, the mechanisms of prostate cancer development and progression have been extensively studied this process is not fully understood. Several genes including MYC and PTEN have been linked to the development of prostate cancer (28). However, one of the most important discoveries in the genetics of prostate cancer is the identification of TMPRSS2-ETS fusion protein that arises as a result of a genetic translocation (4). TMPRSS2 is androgen-regulated transmembrane serine proteases secreted by normal prostatic tissue and an increase in androgen level increases TMPRSS2 expression. ETS family transcription factor (ERG, ETV1, or ETV4) targets genes involved in cell transformation, growth and apoptosis. Therefore fusion of TMPRSS2 gene promoter with one of the member of ETS family results in positive dysregulation of the ETS gene. TMPRSS2-ETS fusion proteins have been speculated to play a role in the development of up to 50% of prostate cancers but not the progression to androgen independence (4). Androgen independent prostate cancer has been postulated to arise as a consequence of increase activity of the androgen receptor (AR), altered cell signalling pathways, or the survival and proliferation of prostate cancer stem cells. Recent papers have conceptualized that cancer can arise from cancer cells with the characteristics of stem cells, unlimited self-renewal and the ability to produce differentiated daughter cells (5). These cells have been termed cancer stem cells (10) and may promote tumour growth, metastasis and relapses, thus having a huge impact on patient survival. The cancer stem cell model hypothesis is that cells with stem cell characteristics accumulate genetic changes over long period of time, escape the environmental control and give rise to cancerous growth. There is good evidence that cancer stem cells cause leukaemias and it has also reported that cancer stem cells can contribute to solid tumour development in brain, breast, colon and prostate. As prostate cancer is a heterogenic disease, several distinct cancer stem cell populations maybe present in a tumour (5). On basis of this knowledge, the role of cancer stem cell is been explored in solid tumours. For instance in prostate cancer mutation of the androgen receptor may result in the growth of tumour that can sustain androgen deprivation or very low level of androgen or use alternative pathways involving growth factors and cytokines. Recent studies (6) have also identified mammary stem cells as being a potential source of breast cancer, tumour relapse and tumour metastasis. For this reason it is vital to understand the stages of cell differentiation in normal prostate epithelium and identification of cells that are involved in prostate carcinogenesis and androgen independent prostate cancer. The prostate is a glandular organ comprising of three distinct epithelial cell populations that may contribute to tumorigenesis (7). Each prostatic duct is lined by nonsecretory basal cells which form a layer along the basement membrane (figure 1). Luminal cells are the major secretory cell, producing 30% of seminal fluid components and lining the lumen of duct and acini. These luminal cells are highly differentiated and expresses prostate specific antigen, cytokeratin 8 and 18 and the nuclear androgen receptor (27). Neuroendocrine cells are also present along the basement membrane and secrete neuroendocrine peptides that support epithelial growth and viability. Vascular components and stromal endothelial cells are also present in the gland. Figure 1. Schematic presentation of the cell types within a human prostatic duct. (Adapted from Abate-Shen, C. Shen, M et al 2000) Recent evidence has suggested stem cells are also present within the prostate cancer cell population. It have been theorized that stem cells may lie in the basal layer of prostate in man and in the basal and luminal compartments in mice (19). A transient amplifying population of daughter cells arises from these stem cells and generates differentiated PSA producing cells in man. Stem cells can have different characteristics, including resistance to apoptosis and increased expression of multidrug resistant transporters (8, 23, 24, 25 ). The findings of Collins et al 2001 (9) revealed that stem cells can be distinguished from the transient amplifying cells and showed there is 2-3 fold increases in expression of surface level of integrin 21. Figure 2. Hypothetical model of stem cells showing normal prostate development and prostate cancer (De Marzo MA et al 1998). De Marzo MA et al 1998 in his paper states pluripotent stem cells are capable of differentiation and self-renewal and is present in the basal epithelium of the prostate, which contains cytokeratin 5 and 14 expressing cells (figure 2). Intermediate progenitor populations located within the basal epithelium expresses both basal and secretory cell characteristics (11). Intermediate cells with limited proliferative capacity can differentiate into mature secretory luminal (androgen receptor positive) or neuroendocrine cells which are non-proliferative. In prostate cancer, it is proposed that transformation occurs which leads to the proliferation of cells with stem cell characteristics and the production of an excess of cells with luminal characteristics (Bisson and Prowse 2009). Normal murine prostate stem cells have been functionally identified by their ability to form prostate spheres (13) and to form differentiated prostate tubular structures when returned to an in vivo environment (13, 14). The in vivo generation of prostate structures from normal human prostate cells in xenograft studies and the ability to isolate a human basal prostate cell population with enriched capacity for prolonged clonal expansion and luminal differentiation have led to the hypothesis that normal human prostate stem cells are located within the basal layer of the gland (15-18). English HF et al 1987 (19) in an experiment found following androgen ablation of rodent prostate glands the stem cells exhibited regenerative properties especially of the secretory cells indicating these cells are self- sustainable, which supports the hypothesis that stem cells reside within the basal layer of the gland and are able to survive in absence of androgen environment. These cells may also therefore have the ability to survive androgen deprivation therapy and contribute to the development of metastatic prostate cancer. At present proper characterization of stem cells has been limited by the absence of specific markers that distinguishes stem cells from their more differentiated progeny. Gene expression and microarray profiling may be able to identify specific markers. These markers may also be prognostic for patient response to therapy and survival. Past papers have discussed non-adherent culture media techniques to isolate neuronal, colon and breast cancer cells that exhibited stem cell characteristics. In a recent paper by Bisson and Prowse et al 2009 (10) the authors studied prostate cancer cell lines (22RV1, DU145, PC3, VCaP, LNCaP and the LNCaP subline C4-2B) and were able to form prostosphere in non adherent culture conditions. Prostosphere were able to form from both AR positive (LNCaP, VCaP, 22RV1) and AR negative (PC-3, DU145) cell lines. Analysis of marker protein expression of proliferation (ki67) and differentiation (keratin 18 and PSA) of prostosphere revealed that cell heterogenecity existed within the prostaspheres, which may be due to different percentages of stem cells within the cell lines or maybe related to adaptation to their environment in the nonadherent culture conditions. Immunoflourescence (Figure 4) of these prostospheres with stem cells associated markers (CD44, CD133, ABCG2) showed increase in expression compared with the adherent cultures, consistent with enrichment for stem cells. However this analysis was only performed by immunofluorescence, and was limited by the semi-quantifiable nature of this technique and the antibodies available (10). Aim Quantitative analysis of cells with stem like characteristics in prostate cancer has not been attempted yet. The aim of my project is therefore, quantitative PCR (QPCR) analysis of stem cells associated gene expression of the prostosphere compared to that of the adherent culture. Material and Methods For my project I used the prostate cancer cell lines DU145, LNCaP and the LNCaP subline C4-2B. The prostasphere formation (P0) is highest in the cell types of LNCaP and its androgen independent derivative C42B, which both express AR and PSA (23). I conducted my experiments by real time PCR to measure the mRNA level of expression on cDNA extracted from prostasphere of LNCaP and subline of LNCaP, C42B cell line. This assay is both qualitative and quantitative and allowed me to compare the RNA gene expression in relation to the control (GAPDH). However there are certain limitations of using this method in my experiment. The prostasphere is heterogenic and the stem cell population within probably only a small fraction of the cells. Therefore it will be interesting to see how this affects the gene expression of the mRNAs. Cell Culture Prostate cancer cell lines LNCaP, C42B and DU145 were cultured at 37C in RPMI using 10% fetal bovine serum (Invitrogen), 2.4 mM glutamine (Sigma-Aldrich), 1% (v/v) pyruvate (Sigma-Aldrich), penicillin and streptomycin (50 U and 50 g/ml) (Invitrogen). Trypsin (Sigma-Aldrich) was used to detach adherent cells, prior to cell counting, passage or analysis (10). Prostasphere cultures were established on low attachment 6-well plate (Costar) when single cells were plated in DMEM/F12 (Invitrogen) supplemented with B27 and N2 (Invitrogen) and grown under these conditions for 6-12 days (Bisson and Prowse 2009). These proliferating spheres of cells are enriched for stem cells (Bisson and Prowse 2009) and were prepared for these experiments by Dr Prowse. The prostasphere medium was also supplemented with WNT3a at 20g/ml (RD Systems) and the Hedgehog pathway inhibitor cyclopamine for 6 days prior to analysis. RNA Extraction RNA was extracted from prostate cancer cell lines LNCaP, C42B and DU145 cells (stored at -70C and thawed at 37c before extraction) using RNeasy Kit (Superscript II enzyme and Poly-A primer) from Qiagen. 600l of RLT Plus (10l of -mercaptoethanol was added to 1ml of RLT Plus buffer prior to the experiment) was added to the cells. The lysate was then added to the QIAshredder spin column sitting on a 2ml eppendorf and centrifuged for 2 minutes at maximum speed (14000 x g). The flow through was transferred to another tube and an equal volume of 70% ethanol was added and mixed by pipetting several times. 700l of the samples was added to a RNeasy spin column and centrifuged for 15 secs for 14000 x g. The flow through was discarded and 700 l of buffer RW1 (supplied) was added to the spin columns and centrifuged for 15 secs at 14000 x g. The flow through was discarded and the column was placed on a new collection tube. 500 l of buffer RPE was added to the column and centrifuged for 2 minutes to dry the RNeasy membrane. To further dry the membrane the column was placed on another tube and centrifuged at maximum speed for one minute to completely dry the column and to remove the trace of RPE buffer. The column was then transferred to another collection tube and 30 l of RNAse free water was added. Finally the tube was centrifuged for one minute (14000 x g) and the elute collected. The RNA was stored at -80C freezer (detailed protocol attached in Appendix). Reverse transcription c-DNA synthesis was done by using SuperscriptTM III First-Strand Synthesis System for RT-PCR. According to the manufacturers instruction 2 l (2 g) of previously prepared RNA was added to 1l of 50uM oligo (dT)20, 1l of 10mM dNTP mix in a tube and DEPC-treated water added to make a volume of 10 l. The reaction tube was incubated at 65C for 5 mins and then placed on ice for one min. In another tube 2 l of 10X RT buffer, 4l of 25mM Mgcl2, 2 l of 0.1DTT, 1 l of RNaseOUTTM (40U/ l) and 1 l of SuperScriptTM III RT (200 U/ l) was added. The 10 l mix of the first tube was added to the second tube and incubated for 50 mins at 50C. The reaction was terminated by incubating at 85C for 5mins and then chilled on ice. 1 l of RNase H was added to the tube and incubated for 20 mins at 37C. The total yield of cDNA was 25 l and this was stored at -20C till further use. Polymerase Chain reaction Polymerase chain reaction was carried out on the cDNA synthesized, using GREX-f* primer GAGTACCTCTGGAGGACAGA and GRINTRON-r* primer ATGCCATTCTTAAGAAACAGGA. For each reaction 5 l of 10xPCR buffer II, 3 or 6 l of 25mM MgCl2, 4 l of 10mM dNTP, 1 l of forward and reverse primer at 10 M and 0.25 l of AmpliTaq Gold Enzyme were mixed in a tube. cDNA at 10 ng/l was added to the reaction tube and made upto 50 ul with deionised water. The reaction was run at 94C for 6 min, and then 35 cycles of 94C for 30 secs, 55C for 30 secs, 68C for 30 secs, 72C for 30 secs followed by 72C for 6 mins. Gel Electrophoresis In order to see the purity of the cDNA synthesized (not contaminated with genomic DNA) gel electrophoresis was carried out. 2% Agarose Gel was prepared with TBE and cyber red added as a fluorescent tag. The gel was poured on a gel plate and a comb was inserted and ran for 30mins at 90V. Relative Quantitative PCR In real-time quantification technology the TaqMan MGB probes contain: A reporter dye (6-FAM) linked to the 5 end of the probe. A minor groove binder (MGB) that increases the melting temperature (Tm) without increasing probe length (Afonina et al., 1997; Kutyavin et al., 1997); it also allow the design of shorter probes. A nonfluorescent quencher (NFQ) at the 3 end of the probe 5 Nuclease Assay Process A TaqMan probe contains a reporter dye at the 5 end and a quencher dye at the 3 end of the probe. The DNA polymerase cleaves the TaqMan probe during PCR and separates the reporter dye and quencher dye. This cleavage results in increased fluorescence of the reporter dye (26). Figure 3.TaqMan probes require a pair of PCR primers in addition to a probe with both a reporter and a quencher dye attached. When the probe is cleaved, the reporter dye is released and generates a fluorescent signal (Invitrogen). The reporter dye does not fluoresce if the probe is intact. During PCR, if the target of interest is present, the probe specifically anneals between the forward and reverse primer sites. On the other hand if the probe hybridizes to the target the DNA polymerase cleaves the probes between the reporter and quencher. The fragmented probes then separate from the target of interest and further polymerisation of the strand continues (26). For quantification of the change in expression of mRNA the ABI 7500 was used to perform the thermal cycling, data collection and data analysis. In a MicroAmp 96 well plate (Applied Biosystem) 10 l of final volume of TaqMan mix was placed. The mixture included 5l of TaqMan Gene Expression Assay, 0.5 l of the primer, 0.5 l of GAPDH (endogenous Control) and 4 l of 1:3 diluted samples. Prior to this study Ct value (cycle threshold) with a standard curve (Fig 5) was constructed and the primer and GAPDH concentration were determined by optimisation studies. All the primers were purchased from applied biosystem and are listed in Table 1. Using the ABI 7500 system the PCR was carried out at 50C for 2 min, followed by 95C for 10 mins. Then 40 cycles of 95C for 15 secs and 60C for 60 secs were performed. Mean relative quantification (RQ) was evaluated using the Ct method using GAPDH as endogenous control. Prior to analysis the PCR products were run on a 2% agarose gel to confirm that the templates have amplified along with GAPDH as endogenous control (figure 5). DATA Analysis The data generated from the RT-PCR were analysed using the recommended threshold by Applied Biosystem and then exported in Excel format. For calibration and generation of standard curves several cDNA cell lines were used: cDNA from DU145, LNCaP and C42B. The slope of the standard curve was calculated from the log input of cDNA in ng/l versus the corresponding Ct value. Basic statistical analysis was performed in Excel. Results Cell Culture Dr Prowse used a non adherent technique suspension culture and identified a group of cells within the prostate cell lines 22RV1, DU145, PC3, VCaP, LNCaP and C42B that had the ability to form prostasphere (Figure 4a). Furthermore using the clonal growth assay, each prostasphere was able to grow a further 1-3 prostaspheres (5b) when dissociated to single cells (10). These prostasphere along with prostate cell lines were used in this study. Immunoflourescence conducted by Dr Prowse on the prostate cancer spheres derived from single cells are illustrated in Figure 4A. Figure 4. Representation of prostasphere formation, culture and the effect of Wnt3a on Keratin 18, CD44 and ABCG2. A) Prostasphere shows self renewal and proliferation and this is a schematic representation of this process. B) Prostasphere formation with 0.1% DU145, 8% LNCaP and 8% of C42B cell lines. C) Effect of Wnt3a on keratin 18, CD44 and ABCG2 (Bisson and Prowse et al 2009). RNA extraction and RTPCR Upon RNA extraction of the cells lines and prostospheres the concentrations were measured by spectrophotometer. It was 234ng/l for C42B and 190ng/l for DU145 respectively. A PCR was conducted with glucocorticoid receptor gene intron primers and gel electrophoresis was carried out to verify the purity of the samples. Only genomic cDNA of LNCaP and Hela cells amplified under 3 mMMg++ conditions (Figure 5). Figure 5. A) Results of quantitative RT-PCR analysis. The PCR in Lanes 1-5 contained 1.5mM Mg++ and lanes 6-10 contained 3mM Mg++. (B) A 2% gel was run with the PCR products that were amplified in Real Time PCR. Lane 1 represented BMI-1, lane 2 NSE, lane 3 ABCG2, lane 4 Nestin, lane 5 K18, lane 6 CD44, lane 7 OCT4, lane 8 PSA, lane and lane 9 sca-1.In all the lanes except lane 8 a double band was observed. The two bands represented GAPDH and the gene of interest. For construction of a standard curve, serial dilutions (1ng/ l, 5ng/l, 20ng/ l and 50ng/ l) of cDNA were used. In all cases, there was a strong linear correlation between the number of thermal cycles required to generate a significant fluorescent signal above background and the log of the input cDNA amount (correlation coefficient 0.90) (Figure 6). The Ct value was against the log of the initial template amount and subjected to linear regression analysis. Figure 6. Real time RT-PCR: standard curves for cDNA obtained from LNCaP, C42B and DU145 cell lines at 1ng/l, 5 l, 20 l and 50 l . A strong linear correlation between the CT values and the log of the input cDNA amount (correlation coefficients ranging from 0.97 to 1.0) were obtained. Quantification and Comparison of the Real Time Quantitative RTPCR results between Adherent cells untreated Prostasphere and treated Prostasphere. Delta Ct values for adherent cells and their correlation with those for prostasphere treated and untreated samples showed high correlation (r 2 90) emerged for all of the tested genes ( Figure 6). GAPDH was used as endogenous control. In order to quantify the gene expression of the prostasphere and treated prostasphere (wnt3a and cyclopamine) to adherent cells (C42B and LNCaP), 10 markers were compared by Q-PCR using GAPDH as endogenous control (Fig 8). The PCR products were resolved on a 2% gel to confirm the templates have amplified along with GAPDH as endogenous control (Figure 5). Duplex product was seen in most of the lanes. The method of calculation was by Ct method. This method calculates the fold change in respect to the normalized gene. In our study we have compared the fold changes of gene expression of the treated and non treated prostosphere relative to the cell line (C42B and LNCaP). In the table (Table 2) we calculated delta delta Ct in relation to the cell line. Each of the samples were run in triplicates, therefore an average of those three were taken in each cases. For example for C42B spheres, the Ct values are 30.19, 29.92, and 30.27. The average of this was taken (30.19, 29.92, 30.27)/3 which is 30.13 and the same was calculated for GAPDH which is 18.94. In each case that is sphere, C42B wnt3a treated, C42B control (dissolved in DMSO) and spheres treated with cyclopamine the average Ct was calculated. Table 2. Example of calculation for quantification of gene expression in fold changes. Sample Average Ct a of samples b Average Ct of GAPDH Ct Ct RQ Values d Prostasphere 30.13 18.94 11.19 -2.01 4.04 Prostasphere +Wnt3a 31.20 19.75 11.46 -1.74 3.34 Prostasphere control 33.97 22.7 11.27 -1.93 3.82 Prostasphere+ cyclopamine 30.28 19.43 10.9 -2.35 5.09 Adherent Cells c 13.20 0 1 a.Cycle threshold. b.Prostasphere, Prostasphere+wnt3a, Prostasphere control, Prostasphere +cyclopamine. c. For adherent cells the Ct value was calculated from the standard curve. d. Relative quantification or fold changes. Ct was calculated by subtracting the Ct of the endogenous control (GAPDH) from the Cts of the gene of interest eg 30.31-18.94=11.19. Fold changes are calculated relative to the adherent cells. Therefore Ct is calculated by subtracting the Ct value of the adherent cells from the Ct of the sample i.e.11.19-13.20=-2.01. Relative quantification (RQ) value of gene expression was calculated by the use of the equation RQ= 2-Ct RQ=2-(-2.01) Therefore an RQ or fold change relative to the adherent cells is 4.04. Figure 7. Q-PCR analysis of the mRNA levels of Nestin, Sca-1, Oct4, BMI-1, NSE, K18, PSA, CD44, ABCG2 and c-kit. Expressions of the markers were calculated by employing the Ct method. (A) Nestin expression was decreased in prostaspheres in C42B adherent cell, prostasphere treated and untreated and were insignificant. (B). Effect of Sca-1 on C42B was unchanged between adherent cells and the prostaspheres. However in LNCaP a modest increase was observed. (C) The prostasphere expressed nearly two fold increase in expression. (D) Oct4 expressed about four fold increase in prostasphere treated samples (Wnt3a and cyclopamine). (E) In LNCaP Oct4 expression is reduced in Wnt 3a treated prostasphere. (F) In C42B prostasphere and Wnt3a treated prostasphere BMI-1 showed slight increase in level of expression. (G) However this change is not as pronounced in LNCaP. (H) NSE marker shows very high expression for C42B prostosphere control and marked reduction when treated with cyclopamine. (I) In LNCaP, no such change was observed between Prostasphere and Wnt3a treated prostasphere. (J and K) Keratin 18 shows extremely high levels in prostasphere with reduction when treated with Wnt3a or cyclopamine. (L and M) PSA failed to show significant changes in the level of expression. Although wnt3a and cyclopamine treated samples showed slight reduction. (N and O) CD44 was not expressed in both C42B and LNCaP prostosphere. However the adherent cells had high expression of the marker. (P) ABCG2 shows high expression of prostasphere in C42B. Wnt3a treated spheres showed reduced levels. (Q) In case of LNCaP extreme level of expression of ABCG2 was observed in prostosphere. (R) c-kit/CD117 was expressed more in the prostasphere with reduced expression on the Wnt3a treated and cyclopamine treated samples. Nestin and CD44 showed significant reduction in expression compared to the adherent cells of C42B. Nestin expressed less than 1% in prostasphere (figure 8A,) and negligible expression of CD44 (figure 7N) in C42B. There is increase in expression of SCA-1, OCT4, BMI-1, K18, ABCG2 and C-KIT (Figure 7 B, C, F, J, K, p, Q and R). NSE showed significant increase (Figure 7 H) in prostasphere control (97% more expression than adherent cells) and 100% increase in expression of K18 prostasphere(Figure J and K) and 100% increase expression of ABCG2 in prostasphere, prostasphere treated with cyclopamine treated and control. Interestingly Wnt3a treated prostasphere showed reduced expression of ABCG2 (Figure 7 P and Q). In LNCaP expression of CD44 is insignificant (0.01%) and PSA expression is reduced by 40% (Figure O and M). In case of LNCaP there was 18% increase in expression of SCA-1, 16% of BMI-1, 50% in NSE, 100% in case of Keratin 18 (Figure 7 C, G, I, and K). A summary of the results are shown in table 3. Table 3. Comparison of fold changes in mRNA expression in 10 selected genes determined by real-time quantitative polymerase chain reaction (RT-qPCR). Discussion Collins et al 2005 (41) in their paper states tumour cells are organised as hierarchy that are responsible for the formation of cancer. They have been able to identify and characterise cancer cell population from prostate tumours that have the ability of cell renewal and regenerate expressing differentiated cell products. Various studies have developed non-adherent sphere culture to characterise cancer cells with stem cell like characteristics. In vitro culture in unattached conditions where cells grow in round balls called spheres is routinely used for enrichment and propagation of stem cells (40). Prostate cancer is a heterogenous disease and to study the prostate cancer cells with stem cell characteristics prostasphere were cultured by Dr Prowse. Previous papers have established stem cell markers namely CD44+, CD133, ABCG2, 21 integrin, Sca-1 and -catenin and PSA can be utilized to identify stem cell population in normal prostate (29,30).However the role of CD117 is yet to be defined in human. Figure 8. The self renewal capacity of cells with stem cell characteristics and the proliferation/differentiation of transit amplifying cells are regulated by WNT signalling. In addition AR activity is the driving force behind proliferation and differentiation of the transit amplifying cell. -catenin which is also an effector of WNT signaling can interact with the activity of AR (Bisson and Prowse et al 2009). In the paper by Bisson and Prowse (10), the authors provide evidence that in absence of AR, WNT activity can control the cell renewal capacity of the prostate cancer cells with stem cell characteristics. On basis of their conclusion they suggested a model (figure 2) where the balance of WNT and AR activity not only regulates the self renewal of prostate cancer cells with stem cell characteristics but also the proliferation and or differentiation of the transit amplifying cells. In my study I tried to characterise the stem cell population within the prostate using different stem cell and differentiation markers and measuring their relative gene expression. This evidence can be used to further charaterise tumour stem cells: as they may comprise only a fraction of the cells responsible for the tumour, and have the abilities of self renewal, proliferation and differentiation. Nestin a neuronal marker, is an intermediate filament protein that identifies progenitor cells in adult tissues. Previous papers (31) have provided evidence of detectable levels of Nestin mRNA and these levels were increased in case androgen-insensitive prostate cancer cell lines (DU145). They were undetectable in the androgen dependent cell line LNCaP. While in C42B, Nestin was expressed only in the adherent cells (Fig 8a). Embryonic stem cell marker such as Sca-1 are used to enrich properties such as, replication quiescence, androgen independence, multilineage differentiation and is capable of promoting regenerative capacity of prostate; in short characteristics of stem cells. In consistent with recent reports (32) our study indicated LNCaP cells grown in anchorage independent conditions showed increase in expression of Sca-1 (Figure 8c). Similarly Oct-4 responsible for stem cell self-renewal (33, 34) showed increase expression in C42B prostasphere (figure 8d). NSE is one of the prognostic indicators of aggressive androgen-independent prostate disease. Neuroendocrine cells provide growth and survival signals to surrounding tumour cells and thereby results in an increase in stem cell population (35, 38, 39). Gene expression is significantly increased in LNCaP prostasphere (Figue 8i). This maybe due to acquisition of the neuroendocrine characteristics by LNCaP in response to long-term androgen ablation therapy (35) or the selective differentiation of prostate cancer stem cells into neuroendcrine cells by non-adherent culture. A recent paper (10) investigated the role of WNT on the size and the self renewal capacity of the prostasphere. The authors noted a significant increase of keratin 18 and CD44 expression with the addition of Wnt3a. This increase in expression was detected in adherent and non adherent cultures with LNCaP prostasphere exhibiting slightly higher level than C42B. CD44 is an important marker with a distinct role in migration and signalling and is present in both stem and differentiating cell population. Evidences have been provided that show CD44 to be present in tumourinitiating cells (36, 37). Therefore it is probable the CD44 would exhibit high expression in the prostasphere and this has been reported in published papers. However in my analysis, (Fig 8N and Fig 8O) shows absences of CD44 expression in both LNCaP and C42B prostasphere although it was possible to construct the standard curve for CD44 with DU145 (figure 8i). Previous studies have provided evidence of reduced expression of CD44 in LNCaP and C42B cell lines. This is probably been reflected in this study. Immunoflourescence done by Dr Prowse (Figure.4C i-vi) described the effect of Wnt3a on keratin 18, CD44 and ABCG2. Their findings were increase of expression of CD44 on Wnt3a treated spheres. Keratin 18 is present in most adenocarcinomas. Levels of K18 increases dramatically in prostosphere but interestingly it is more so when treated with Wnt3a (Figure 8 J). Immunflourescence (Figure 4 I, ii) of K18 shows similar effects (10). This might suggest WNT signalling may promote cell renewal and differentiation (42, 43). Similarly in case of ABCG2 Dr Prowse provided data of immunoflourescence that showed increase in 40% of LNCaP spheres, and 100% in C4-2B spheres. ABCG2 is a haematopoietic marker expressed in variety of stem cells (44). My study shows similar results. Another promising marker c-kit/CD117 has not been fully explored. In murine prostate studies have showed CD117 maybe responsible for self renewal and is capable of regeneration of functional and secretion producing prostate when transplanted in vivo (14). My analysis shows increase in expression in prostasphere with reduced expression in treated samples. This finding seems to be promising although further studies are required. BMI-1 is responsible for proliferation and self renewal capacity and PSA promotes differentiation. Studies have provided evidence of increased expression of BMI-1 and PSA in stem cells. However mRNA expression of these two markers failed to show significant changes. Characterisation and identification of stem cells are very challenging. For proper characterisation specific markers are needed to be identified. In both cell lines C42B and LNCaP Keratin 18 shows the most fold change in expression. Intermediate cells have limited capacity of proliferation and they can differentiate into luminal cells and neuroendocrine cells. Neuroendocrine cells are non proliferative. However the luminal cells have the proliferation capacity. Keratin 18 is a luminal marker and its high expression suggests the luminal cells can proliferate into cells with stem like characteristics. Another interesting marker ABCG2 shows positive fold change. Studies (46) have provided evidence of a subpopulation of ABCG2+/AR-cells that are capable of isolating cancer stem cells by efflux of androgens. ABCG2 is a haemopoietic marker and is responsible for survival of cells. Furthermore Patrawala et al 2005 provides that ABCG2- cells are capable of generating ABCG2+ cells in large clones. Increase of expression of ABCG2 in the QPCR analysis may suggest in hypoxic conditions cells are able to survive and are rapid progenitors (45). My quantitative analysis of the ten markers provides preliminary data of the heterogenecity of prostate cancer cells with stem like characteristics. However it should be kept in mind that the profile of markers may change according to the site of origin and maturity of the stem cells. Overall my datas are very promising but they are at the preliminary stage. In my study I did not replicate the experiments three times which is very much required for validation. Furthermore I have looked in two cell lines and experiments should be conducted for the other cell lines as well. The other things to consider are the shortcomings of the Q-PCR method. A number of variabilities such as RNA degradation, data analysis can change the result. Future direction of work would be addressing the above limitations and exploration of its potential in diagnostic settings. References: Cancer Research UK. 2. Charles Huggins S. Endocrine-induced regression of cancers Nobel Lecture, December 13, 1966. 3. Petrylak DP, Tangen CM, Hussain MH, Lara PN Jr., Jones JA, Taplin ME, Burch PA, Berry D, Moinpour C, Kohli M, Benson MC, Small EJ, Raghavan D, Crawford ED: Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. N Engl J Med 2004, 351 (15):1513-1520. 4. Tomlins SA, Rhodes DR, Perner S, Dhanasekaran SM, Mehra R, Sun XW, Varambally S, Cao X, Tchinda J, Kuefer R, Lee C, Montie JE, Shah RB, Pienta KJ, Rubin MA, Chinnaiyan AM (2005) Recurrent fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer. Science 310: 644648. 5. The cancer stem cell hypothesis: in search of definitions,markers, and relevance Michail Shipitsin and Kornelia Polyak Laboratory Investigation (2008) 88, 459463). 6. Breast cancer stem cells: implications for therapy of breast cancer. Morrison BJ, Schmidt CW, Lakhani SR, Reynolds BA, Lopez JA. Breast Cancer Res. 2008;10(4):210. 7. Abate-Shen, and Shen, M.M. 2000. Molecular genetics of prostate cancer. Genes Dev. 14:24102434) 8. What is apoptosis, and why is it important? Renehan AG, Booth C, Potten CS. BMJ. 2001 Jun 23;322(7301):1536-8 9. Stromal cell-derived factor-1 (SDF-1) signalling regulates human placental trophoblast cell survival. Jaleel MA, Tsai AC, Sarkar S, Freedman PV, Rubin LP. Mol Hum Reprod. 2004 Dec;10(12):901-9. 10. WNT signaling regulates self renewal and differentiation of prostate cancer cells with stem cell characteristics. Isabelle Bisson, David M Prowse. Cell Research (2009) :1-15. 11. De Marzo MA, Nelson WG, Meeker AK, Coffey DS: Stem cell features of benign and malignant prostate epithelial cells. J Urol 1998. 12. Matthew Bui and Robert E. Reiter Cancer and Metastasis Reviews 17: 391399, 1999). 13.Xin L, Lukacs RU, Lawson DA, Cheng D, Witte ON. Selfrenewal and multilineage differentiation in vitro from murine prostate stem cells. Stem Cells 2007; 25:2760-2769. 14. Leong KG, Wang BE, Johnson L, Gao WQ. Generation of a prostate from a single adult stem cell. Nature 2008; 456:804- 808). 15.Hudson DL, OHare M, Watt FM, Masters JR. Proliferative heterogeneity in the human prostate: evidence for epithelial stem cells. Lab Invest 2000; 80:1243-1250. 16. Hudson DL, Guy AT, Fry P, et al. Epithelial cell differentiation pathways in the human prostate: identification of intermediate phenotypes by keratin expression. J Histochem Cytochem 2001; 49:271-278. 17. Collins AT, Habib FK, Maitland NJ, Neal DE. Identification and isolation of human prostate epithelial stem cells based on alpha(2)beta(1)-integrin expression. J Cell Sci 2001; 114:3865-3872. 18. Litvinov IV, Vander Griend DJ, Xu Y, et al. Low-calcium serum-free defined medium selects for growth of normal prostatic epithelial stem cells. Cancer Res 2006; 66:8598-8607. 19. Response of glandular versus basal rat ventral prostatic epithelial cells to androgen withdrawal and replacement. English HF, Santen RJ, Isaacs JT. Prostate. 1987;11(3):229-42. 20. Highly purified CD44+ prostate cancer cells from xenograft human tumors are enriched in tumorigenic and metastatic progenitor cells. Patrawala L, Calhoun T, Schneider-Broussard R, Li H, Bhatia B, Tang S, Reilly JG, Chandra D, Zhou J, Claypool K, Coghlan L, Tang DG. Oncogene. 2006 Mar 16;25(12):1696-708. 21.Collins AT, Berry PA, Hyde C, et al. Prospective identification of tumorigenic prostate cancer stem cells. Cancer Res 2005; 65:10946-10951. 22. van Bokhoven A, Varella-Garcia M, Korch C, et al. Molecular characterization of human prostate carcinoma cell lines. Prostate 2003; 57:205-225 23. A distinct side population of cells with high drug efflux capacity in human tumor cells. Hirschmann-Jax C, Foster AE, Wulf GG, Nuchtern JG, Jax TW, Gobel U, Goodell MA, Brenner MK. Proc Natl Acad Sci U S A. 2004 Sep 28;101(39):14228-33. 24. Partial contribution of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)/TRAIL receptor pathway to antitumor effects of interferon-alpha/5-fluorouracil against Hepatocellular Carcinoma. Yamamoto T, Nagano H, Sakon M, Wada H, Eguchi H, Kondo M, Damdinsuren B, Ota H, Nakamura M, Wada H, Marubashi S, Miyamoto A, Dono K, Umeshita K, Nakamori S, Yagita H, Monden M. Clin Cancer Res. 2004 Dec 1;10(23):7884-95. 25. Stromal cell-derived factor-1 (SDF-1) signalling regulates human placental trophoblast cell survival. Jaleel MA, Tsai AC, Sarkar S, Freedman PV, Rubin LP. Mol Hum Reprod. 2004 Dec;10 (12):901-9. 26. Applied biosystem. 27. Identification, Characterization, and Differentiation of Human Prostate Cells.Parmender P. Mehta, Carlos Perez-Stable, Bernard A. Roos, Mehrdad Nadji Methods in Molecular Biology.Vol:137Jan-21-200: 317-335 28. Unopposed c-MYC expression in benign prostatic epithelium causes a cancer phenotype. Williams K, Fernandez S, Stien X, Ishii K, Love HD, Lau YF, Roberts RL, Hayward SW. Prostate. 2005 Jun 1;63(4):369-84. 29. Collins AT, Habib FK, Maitland NJ, Neal DE. Identification and isolation of human prostate epithelial stem cells based on a2h1-integrin expression. J Cell Sci 2001;114:386572. 30. Richardson GD, Robson CN, Lang SH, Neal DE, Maitland NJ, Collins AT. CD133, a novel marker for human prostatic epithelial stem cells. J Cell Sci 2004;117: 353945. 31.Kleeberger, Wolfram, Bova, G. Steven, Nielsen, Matthew E., Herawi, Mehsati, Chuang, Ai-Ying, Epstein, Jonathan I., Berman, David M. Roles for the Stem Cell Associated Intermediate Filament Nestin in Prostate Cancer Migration and Metastasis Cancer Res 2007 67: 9199-9206. 32. Anchorage-independent culture maintains prostate stem cells. Shi X, Gipp J, Bushman W. Dev Biol. 2007 Dec 1;312(1):396-406. Epub 2007 Sep 29). 33. Oct-4: gatekeeper in the beginnings of mammalian development. Pesce M, Schler HR.Stem Cells. 2001;19(4):271-8. 34. Glycoconjugate expression during embryogenesis and its biological significance. Bruce A. Fenderson, E. M. Eddy, Sen-Itiroh Hakomori.BioEssays Volume12, Issue4, Date:April 1990, Pages:173-179 35. Bonkhoff, H, Remgerger, K (1996). Differentiation pathways and histogenetic aspects of normal and abnormal prostatic growth: a stem cell model. Prostate 28:98-106. 36. Patrawala L, Calhoun-Davis T, Schneider-Broussard R, Tang DG. Hierarchical organization of prostate cancer cells in xenograft tumors: the CD44+alpha2beta1+ cell population is enriched in tumor-initiating cells. Cancer Res 2007; 67:6796- 6805. 37. Hurt EM, Kawasaki BT, Klarmann GJ, Thomas SB, Farrar WL. CD44+ CD24(-) prostate cells are early cancer progenitor/ stem cells that provide a model for patients with poor prognosis. Br J Cancer 2008; 98:756-765. 38. Shen R, Dorai T, Szaboles M, Katz AE, Olsson CA, Buttyan R. Transdifferentiation of cultured human prostate cells to a neuroendocrine cell phenotype in a hormone-depleted medium. Urol Res 1997;3:6775. 39. Farini D, Puglianiello A, Mammi C, Siracusa G, Moretti C. Dual effect of pituitary adenylate cyclase activating polypeptide on prostate tumor LNCaP cells: short- and long-term exposure affect proliferation and neuroendocrine differentiation. Endocrinology 2003;144: 163143. 40. Jensen JB, Parmar M. Strengths and limitations of the neurosphere culture system. Mol Neurobiol 2006;34:153161. 41. Collins, Anne T., Berry, Paul A., Hyde, Catherine, Stower, Michael J., Maitland, Norman Prospective Identification of Tumorigenic Prostate Cancer Stem Cells Cancer Res 2005 65: 10946-10951. 42.Clevers H. Wnt/beta-catenin signaling in development and disease. Cell 2006; 127:469-480. moment. J Pathol 2008; 214:3-9. 43.Lo Celso C, Prowse DM, Watt FM. Transient activation of beta-catenin signalling in adult mouse epidermis is sufficient to induce new hair follicles but continuous activation is required to maintain hair follicle tumours. Development 2004; 131:1787-1799. 44. Sheng Zhou, John D. Schuetz, Kevin D. Bunting, Anne-Marie Colapietro, Janardhan Sampath, John J. Morris, Irina Lagutina, Gerard C. Grosveld, Mitsujiro Osawa, Hiromitsu Nakauchi Brian P. Sorrentino . The ABC transporter Bcrp1/ABCG2 is expressed in a wide variety of stem cells and is a molecular determinant of the side-population phenotype, Nature Medicine 7, 1028 1034 (2001). 45. L. Patrawala, T. Calhoun and R. Schneider-Broussard et al., Side population is enriched in tumorigenic, stem-like cancer cells, whereas ABCG2+ and ABCG2 cancer cells are similarly tumorigenic, Cancer Res 65 (2005), pp. 62076219. 46. W.J. Huss, D.R. Gray and N.M. Greenberg et al., Breast cancer resistance protein-mediated efflux of androgen in putative benign and malignant prostate stem cells, Cancer Res 65 (2005), pp. 66406650. Appendix Protocols and Supporting documents Protocol: Purification of Total RNA from Animal Cells This protocol requires the RNeasy Mini Kit. Determining the correct amount of starting material It is essential to use the correct amount of starting material in order to obtain optimal RNA yield and purity. The minimum amount is generally 100 cells, while the maximum amount depends on: The RNA content of the cell type The RNA binding capacity of the RNeasy spin column (100 g RNA) The volume of Buffer RLT required for efficient lysis (the maximum volume of Buffer RLT that can be used limits the maximum amount of starting material to 1 x 107 cells) RNA content can vary greatly between cell types. The following examples illustrate how to determine the maximum amount of starting material: COS cells have high RNA content (approximately 35 g RNA per 106 cells). Do not use more than 3 x 106 cells, otherwise the RNA binding capacity of the RNeasy spin column will be exceeded. HeLa cells have average RNA content (approximately 15 g RNA per 106 cells). Do not use more than 7 x 106 cells, otherwise the RNA binding capacity of the RNeasy spin column will be exceeded. NIH/3T3 cells have low RNA content (approximately 10 g RNA per 106 cells). The maximum amount of starting material (1 x 107 cells) can be used. If processing a cell type not listed and if there is no information about its RNA content, we recommend starting with no more than 34 x 106 cells. Depending on RNA yield and purity, it may be possible to increase the cell number in subsequent preparations. Do not overload the RNeasy spin column, as this will significantly reduce RNA yield and purity. Counting cells is the most accurate way to quantitate the amount of starting material. As a guide, the number of HeLa cells obtained in various culture vessels after confluent growth is given in Table 5 SuperScriptTM III First Stand Synthesis System for RT-PCR Amplification of Target cDNA The first-strand cDNA obtained in the synthesis reaction may be amplified directly using PCR. We recommend using 10% of the first-strand reaction (2 l) for PCR. However, for some targets, increasing the amount of firststrand reaction up to 10 l in PCR may result in increased product yield. We recommend the following DNA polymerases (for ordering information, : Platinum Taq DNA Polymerase provides automatic hot-start conditions for increased specificity and sensitivity. It is recommended for targets up to 4 kb. Platinum Taq DNA Polymerase High Fidelity provides increased fidelity and higher yields for targets up to 15 kb. Platinum Pfx DNA Polymerase possesses a proofreading 3 to 5exonuclease activity and provides maximum fidelity for PCR. It is recommended for targets up to 12 kb. Protocol for DNA Amplification A Master mix of reagents (water, dNTPs, Primers and Enzymes) for all samples can be prepared fast and then aliquoted to individual tubes. Magnesium chloride and the template DNA are then added. Using such mixes would reduce pipetting loss, increase accuracy and reduce the number of transfers. Perform Amplification in Applied Biosystem PCR tube. DNA may stick to the plastic and since the nuclease are found on the surfaces sterile siliconized tubes and tips are used.

Saturday, May 23, 2020

Mahatma Gandhi - 1029 Words

Mahatma GandhiMohandas Karamchand Gandhi (Gujarati: à ª ®Ã  «â€¹Ã  ª ¹Ã  ª ¨Ã  ª ¦Ã  ª ¾Ã  ª ¸ à ªâ€¢Ã  ª °Ã  ª ®Ã  ªÅ¡Ã  ªâ€šÃ  ª ¦ à ªâ€"à ª ¾Ã  ªâ€šÃ  ª §Ã  «â‚¬, pronounced [moË Ã‰ ¦Ã‰â„¢nÃŒ ªdÃŒ ªaË s kÉ™rÉ™mÊ ¨Ã‰â„¢nÃŒ ªdÃŒ ª É ¡aË nÃŒ ªdÃŒ ªÃŠ ±iË ] ( listen); 2 October 1869 – 30 January 1948) was the pre-eminent political and spiritual leader of India during the Indian independence movement. He pioneered satyagraha—resistance to tyranny through mass civil disobedience, a philosophy firmly founded upon ahimsa, or total nonviolence, which helped India to gain independence, and inspired movements for civil rights and freedom across the world. Gandhi is often referred to as Mahatma Gandhi ([mÉ™É ¦aË tÃŒ ªmaË ]; Sanskrit: à ¤ ®Ã  ¤ ¹Ã  ¤ ¾Ã  ¤ ¤Ã  ¥ Ã  ¤ ®Ã  ¤ ¾ mahÄ tmÄ  or Great Soul, an honorific first applied to him by Rabindranath Tagore),[1] and in India also as Bapu (Gujarati: à ª ¬Ã  ª ¾Ã  ª ªÃ  « , bÄ pu or†¦show m ore content†¦The story of Harishchandra, a well known tale of an ancient Indian king and a truthful hero, haunted Gandhi as a boy. Gandhi in his autobiography admits that it left an indelible impression on his mind. He writes: It haunted me and I must have acted Harishchandra to myself times without number. Gandhis early self-identification with Truth and Love as supreme values is traceable to his identification with these epic characters.[5][6] In May 1883, the 13-year old Mohandas was married to 14-year old Kasturbai Makhanji (her first name was usually shortened to Kasturba, and affectionately to Ba) in an arranged child marriage, according to the custom of the region.[7] Recalling the day of their marriage he once said that As we didnt know much about marriage, for us it meant only wearing new clothes, eating sweets and playing with relatives. However, as was also the custom of the region, the adolescent bride was to spend much time at her parents house, and away from her husband.[8]Show MoreRelatedMahatma Gandhi : Gandhi ( Gandhi )1176 Words   |  5 PagesKaramchand Gandhi, also known as Gandhi Ji, Mahatma Gandhi and Bapu. He was a nationalist leader in India, known for establishing freedom in India from British through nonviolent movement. He professed the term’s passive resistance and civil disobedience insufficient for his work, however he devised a term called, Satyagraha (truth and firmness). He worked hi s whole life for peace and freedom in India, which I think, is something to be acknowledged by millions of people. Mohandas Karamchand Gandhi wasRead MoreGandhi : The World Of Mahatma Gandhi1320 Words   |  6 Pages 2016 Research Paper: Gandhi Mohandas Karamchand Ghandi, better known to the world as Mahatma Gandhi is one of the world’s main faces when we think or talk of the Indian independence movements, women’s rights and all around freedom for humanity. This individual used strategies and tactics of his own to achieve justice for the Indian culture while he was alive. Gandhi also worked to reform traditional Indian society in India as he was a mahatma, a Hindu term in the Hindu religion meaningRead MoreMahatma Gandhi Essay986 Words   |  4 PagesMahatma Gandhi Mohandas Gandhi, known as Mahatma Gandhi. Also known as Mahatma the great soul, was the father of modern India. He originally came from Western India, a city called Porbandar. He was born on 2nd October 1869. Gandhi was on of the youngest of the three sons of Karamchand Gandhi, who was a Prime Minister successively in Porbandar, Rajkot and Vankaner States. Gandhis mother was Putlibai, Karamchand Gandhis fourth wife. In 1876 he attended a primaryRead MoreEssay On Mahatma Gandhi1859 Words   |  8 PagesGandhi was born on October 2, 1869 in the small western Indian state of Porbandar under the name Mohandas Karamchand Gandhi (Ghandi s Life) . When Gandhi was finished with high school, he entered a small Indian college, the Samaldas College at the University of Bombay (Mahatma). After beginning his education here, however, he decided he disliked and traveled to the University College London, leaving his wife and infant son (Ghandi s Life). It was while attending school in London that he initiallyRead MoreMahatma Gandhi As A Pragmatism1136 Words   |  5 PagesMahatma Gandhi (Mohandas Karamchand Ghandi) was born on 2nd October 1869 at Porbander Gujarat. Ghandi was born into a middle-class family, he had his early education at Rajkot, he married to Kasturba. Then he went to England for higher studies. He was an average student in his early childhood. He returned to India as barrister. He went to south Africa and did practice as a lawyer. He fought for the rights of Indians living there. He left his practice and came back to India. He had worked for theRead MoreMahatma Gandhi : Assassination Of The Five Affiliating Universities769 Words   |  4 PagesMAHATMA GANDHI UNIVERSITY- PROFILE Mahatma Gandhi University, one of the five affiliating universities in Kerala, is the premier educational institution that strives to fulfil the higher educational needs of the people of Central Kerala. Set on the sprawling 110-acre campus called Priyadarshini Hills at Athirampuzha, 13 kms off Kottayam, the University also has seven satellite campuses in parts of Kottayam and the neighbouring districts. The University was established on 2ndRead MoreEssay on Mahatma Gandhi1642 Words   |  7 PagesESSAY ON MAHATMA GANDHI Mahatma Gandhi was born in the Porbandar city of Gujarat in october 2nd, 1869. His father name is Karamchand Gandhi, the diwan of Porbandar, and his wife, Putlibai. Since his mother was a Hindu of the Pranami Vaishnava order, Gandhi learned the tenets of non-injury to living beings, vegetarianism, fasting, mutual tolerance, etc, at a very tender age. Mohandas was married at the age of 13 to Kasturba Makhanji and had four sons. He passed the matriculation exam at SamaldasRead MoreThe Assassination Of Mahatma Gandhi1912 Words   |  8 Pages Synthesis Essay- Mahatma Gandhi MSgt Tiffany J. Jones Air Force Senior Noncommissioned Officer Academy Mahatma Gandhi 504. 240. 2,555. 6. The number 504 represents the hours spent fasting in hunger strikes against racial injustice. The number 240 represents miles journeyed in protest against unjust taxes. The number 2,555 represents the number of days in prison for civil disobedience. The number 6 represents the number of assassination attempts made. What do those numbersRead MoreEssay on The Life of Mahatma Gandhi695 Words   |  3 PagesAs a child, Mahatma Gandhi (October 2nd, 1869 – January 30th, 1948) he was a shy, quiet boy and considered an average student. He did not show any exceptional qualities, but that made the world that much more intrigued when he became the one of the world’s most respected religious figures. Like the rest of us, Gandhi wasn’t perfect. He experimented with smoking, stealing and eating foods such as meat that were frowned upon in his religious upbringing. By the age of 13, he married his wife KasturbaRead MoreMahatma Gandhi Research Paper1409 Words   |  6 Pages Mahatma Gandhi was a public figure that led India to their release of Great Britain taxes and rule. Mahatma Gandhi was born October 2, 1869 in Porbandar, India where his mother and father (Karamchand Gandhi and Putlibai Gandhi) raised him into a 6 sibling family. Mahatma Gandhi attended Samaldas Arts College in 1891 as that’s where he got most of the education at the college level. Gandhi had 4 sons with his wife Kasturba Gandhi who was born in 1833 and later passed in 1944. Mahatma was later assassinated

Monday, May 18, 2020

What Is Alphas Statistical Significance

Not all results of hypothesis tests are equal. A hypothesis test or test of statistical significance typically has a level of significance attached to it. This level of significance is a number that is typically denoted with the Greek letter alpha. One question that comes up in a statistics class is, â€Å"What value of alpha should be used for our hypothesis tests?† The answer to this question, as with many other questions in statistics is, â€Å"It depends on the situation.† We will explore what we mean by this. Many journals throughout different disciplines define that statistically significant results are those for which alpha is equal to 0.05 or 5%. But the main point to note is that there is not a universal value of alpha that should be used for all statistical tests. Commonly Used Values Levels of Significance The number represented by alpha is a probability, so it can take a value of any nonnegative real number less than one. Although in theory any number between 0 and 1 can be used for alpha, when it comes to statistical practice this is not the case. Of all levels of significance, the values of 0.10, 0.05 and 0.01 are the ones most commonly used for alpha. As we will see, there could be reasons for using values of alpha other than the most commonly used numbers. Level of Significance and Type I Errors One consideration against a â€Å"one size fits all† value for alpha has to do with what this number is the probability of. The level of significance of a hypothesis test is exactly equal to the probability of a Type I error. A Type I error consists of incorrectly rejecting the null hypothesis when the null hypothesis is actually true. The smaller the value of alpha, the less likely it is that we reject a true null hypothesis. There are different instances where it is more acceptable to have a Type I error. A larger value of alpha, even one greater than 0.10 may be appropriate when a smaller value of alpha results in a less desirable outcome. In medical screening for a disease, consider the possibilities of a test that falsely tests positive for a disease with one that falsely tests negative for a disease. A false positive will result in anxiety for our patient but will lead to other tests that will determine that the verdict of our test was indeed incorrect. A false negative will give our patient the incorrect assumption that he does not have a disease when he in fact does. The result is that the disease will not be treated. Given the choice, we would rather have conditions that result in a false positive than a false negative. In this situation, we would gladly accept a greater value for alpha if it resulted in a tradeoff of a lower likelihood of a false negative. Level of Significance and P-Values A level of significance is a value that we set to determine statistical significance. This ends up being the standard by which we measure the calculated p-value of our test statistic. To say that a result is statistically significant at the level alpha just means that the p-value is less than alpha. For instance, for a value of alpha 0.05, if the p-value is greater than 0.05, then we fail to reject the null hypothesis. There are some instances in which we would need a very small p-value to reject a null hypothesis. If our null hypothesis concerns something that is widely accepted as true, then there must be a high degree of evidence in favor of rejecting the null hypothesis. This is provided by a p-value that is much smaller than the commonly used values for alpha. Conclusion There is not one value of alpha that determines statistical significance. Although numbers such as 0.10, 0.05 and 0.01 are values commonly used for alpha, there is no overriding mathematical theorem that says these are the only levels of significance that we can use. As with many things in statistics, we must think before we calculate and above all use common sense.

Tuesday, May 12, 2020

The Birthmark By Nathaniel Hawthorne - 1493 Words

Romantic period authors, like Nathaniel Hawthorne, a prevalent example of a Romantic author from the 19th century, believed that people were getting too reliant on on science. Romantics were literary rebels who wrote about strong emotions, the supernatural, and the power of nature. The writing style of the previous century was known as the Age of Reason, the authors thought emotion was unnecessary; they loved science and wrote a lot of non-fiction. The romantics wanted to remind people that there was nothing more powerful than human emotion and nothing more beautiful than nature. According to Jules Zanger, Hawthorne’s short story, â€Å"suggests his resistance to the expansive materialism of America s new technology as well as to the excessive spirituality of its philosophers.† The short story, â€Å"The Birthmark† by Nathaniel Hawthorne articulates the obsession with human perfection through symbols, characters’, and narrator. Aylmer, a man devoted entirely to his science, marries Georgiana, a beautiful young woman with a single â€Å"earthly imperfection† (291). This imperfection is in resemblance of a tiny â€Å"crimson hand† (292) and is clearly visible on the left cheek of Georgiana. The hand is often associated with the power and the strength of Divinity or God. In the Old Testament, in particular, the hand of the Lord represents â€Å"God in the wholeness of his power and instrumentality (Chevalier and Brant 466). Furthermore, the birthmark itself is both a symbol for the downfall ofShow MoreRelatedThe Birthmark By Nathaniel Hawthorne Essay1615 Words   |  7 PagesA birthmark as referred to in this short story is the â€Å"Differences of temperament†, the inborn traits someone can develop. In Nathaniel Hawthorne s The Birthmark there are many different themes such as, nature versus science, and perfection. We see Aylmer struggle with his own temperament. For him the birthmark becomes the symbol of Georgiana’s flawed humanity, which he tries to alternate. Throughout the story, we come across several observances of otherness revolving around â€Å"The Birthmark†. AylmerRead MoreThe Birthmark By Nathaniel Hawthorne873 Words   |  4 PagesThe Birthmark is a story by Nathaniel Hawthorne the carries vast amounts of symbolism in its pages. It’s a story that you can pretty much look at anything that is involved and see how it carries some type of underlying meaning that either helps the character development or means something entirely different. The basis of the story is similar to that of Mary Shelley’s Frankenstein, which only came out about 20 years before The Birthmark. For the most part the story is about human imperfection andRead MoreThe Birthmark By Nathaniel Hawthorne1511 Words   |  7 PagesThe Birthmark Nathaniel Hawthorne like many other writers during the nineteenth century focused their writings on the darker aspects of life. â€Å"The Birthmark,† is set in New England and has a Puritan perspective. Aylmer, a well-known scientist, marries Georgiana who has a hand shaped birthmark upon her face. After some time during their marriage Aylmer and Georgiana decided to remove the mark through scientific means. Advancements in science and the ability to change nature were at the center ofRead MoreThe Birthmark By Nathaniel Hawthorne2570 Words   |  11 PagesRawan Jabr Professor Stafford English 102 November 9th 2014 Nathaniel Hawthorne’s â€Å"The Birthmark† â€Å"The Birthmark† is a short story authored by Nathaniel Hawthorne and published in 1848. The story is about Aylmer, a brilliant scientist who is obsessed with science and is planning to use his experiments to remove a birthmark on the face of his wife Georgiana. Aylmer’s love for science made him yearn to obtain control of the entire divinity. His wife was among his victims of science that was strongerRead MoreThe Birthmark By Nathaniel Hawthorne1185 Words   |  5 PagesAli Qutab Honor American Literature â€Å"The Birthmark† : Essay #4 December 30th, 2015 The Effect of Nature on the Scientific Ego of Aylmer Throughout, â€Å"The Birthmarkâ€Å", by Nathaniel Hawthorne, symbolism and imagery are used to show that Aylmer s attempt to perfect something natural is the cause of Georgiana s death and that when man manipulates something as powerful as Nature, terrible things can occur. Aylmer is a scientist whose strives for perfection and is blinded by his love for science, resultingRead MoreThe Birthmark By Nathaniel Hawthorne1707 Words   |  7 PagesMany of Nathaniel Hawthorne s stories are based off of morality and is heavily influenced by religious beliefs and women. Hawthorne published The Birthmark, a parable, dark romanticism, at a time when people praised the scientific method and were starting to think science could make anything possible. He set his story about sixty years earlier in the 160-year-long wake of the Newtonian Revolution, in the Age of Enlightenment, when science was gaining recognition. His story argues that, despiteRead MoreThe Birthmark By Nathaniel Hawthorne923 Words   |  4 PagesIn Nathaniel Hawthorne s â€Å"The Birthmark†, we find the tragic story of a woman named Georgiana who sacrificed her life for the sake of appeasing her husband, Aylmer. What did Georgiana do that it was more favorable for her to die than to continuing to displease her husband? Georgiana, who was otherwise hailed as incomparably beautiful, had a birthmark on her face. Aylmer desired this to remove this birthmark, which he considered the one thing keeping her from being â€Å"perfect†, from her face. In anRead MoreThe Birthmark By Nathaniel Hawthorne913 Words   |  4 Pagesstory The Birthmark, Nathaniel Hawthorne used Aylmer and his wife Georgiana to display that no person can be perfect. He does this by using Aylmer obsession with perfection and science. His wife Georgiana beauty is amazing and almost perfect, except for a crimson scar on her check that looks like a hand. Aylmer wants to remove the mark that symbolizes imperfection, sin, and mo rtality; though it could result in death. In the act, he is acting like God. Hawthorne’s argument in The Birthmark is our imperfectionsRead MoreThe Birthmark By Nathaniel Hawthorne Essay1399 Words   |  6 PagesThe Birthmark Criticism Analysis The short story â€Å"The Birthmark† by Nathaniel Hawthorne was written in 1843 at the beginning of the largest feminist movement in the United States of America which occurred between the years 1840 and 1920 (National). Furthermore, during the 1830s and 1840s there were many women who spoke out about women’s rights. They argued for many changes with one of them being a social change in their duties to be subdominant to males. They rallied around the prohibition by fightingRead MoreThe Birthmark By Nathaniel Hawthorne1081 Words   |  5 PagesIn Nathaniel Hawthorne’s short story, â€Å"The Birthmark†, the narrator immediately reveals Aylmer’s unusual obsession to his wife’s, Georgiana, hand-like birthmark. Aylmer’s abnormal obsession is so extensive, the birthmark even consumes him in his sleep dreaming of an operation for the removal and cringing anytime he sees it. Georgiana is completely in love with Aylmer that she’ll do an ything to make him happy, even jeopardize her own life undergoing procedures to remove the birthmark. Within the narrative

Wednesday, May 6, 2020

Essay on Creon as the Tragic Hero in Sophocles Antigone

Creon as the Tragic Hero in Antigone This essay will compare two of the characters in â€Å"Antigone†, Antigone and Creon, in an effort to determine the identity of the tragic hero in this tale. To identify the tragic hero in Sophocles’ renowned play â€Å"Antigone†, we should first consider both the elements present in Greek tragedies and what characteristics define a tragic hero. Aristotle’s definition of tragedy is: â€Å"Tragedy is a story taking the hero from happiness to misery because of a fatal flaw or mistake on his part. To be a true tragic hero he must also elicit a strong emotional response of pity and fear from the audience. This is known as catharsis or purging of emotion.† In most cases the tragic hero begins†¦show more content†¦This illustrates that although she begins the play in misery she continues to suffer throughout the play. Antigone has a possible flaw in that she is too stubborn and persistent to obey Creon’s order; â€Å"I know my duty, where true duty lies† (Antigone, 128). Her punishment then encourages feelings of pity from the audience because her deed was honorable and respectful towards her brother Polynices. The chorus supports this view by bidding her a respectful farewell when she is taken away, â€Å"But glory and praise go with you lady† (Antigone, 148). Antigone is also very proud, and this may have contributed to her death. Even when she is caught she remains strong and defends herself by claiming that the chorus thinks that her act was honorable, â€Å"All these would say that what I did was honorable† (Antigone, 139). This causes Creon to remain angry with Antigone, â€Å"you are wrong, none of my subjects think as you do† (Antigone, 140). If she had been more patient and less defensive, Creon may not have been as harsh in the punishment he set for her . Creon, who received the throne after the banishment of Oedipus, begins â€Å"Antigone† with high status as the king of Thebes. He is fortunate to be honored as Thebes’ appointed king during her triumph over the army of Polynices, â€Å"Creon, son of Menoeceus, Whom the gods have appointed for us in our recent change of fortune† (Antigone, 130). AfterShow MoreRelated Creon as Tragic Hero of Sophocles Antigone Essay593 Words   |  3 PagesCreon as Tragic Hero of Sophocles Antigone There has always been a bit of confusion as to the tragic hero of the Greek Drama Antigone. Many assume that simply because the play is named for Antigone, that she is the tragic hero. However, evidence supports that Creon, and not Antigone, is the tragic hero of the play. Examining the factors that create a Greek Tragedy, and a tragic character, it is clear that the tragic hero is in fact Creon. First, take into account the timeframe in whichRead MoreEssay on Creon as the Tragic Hero of Sophocles Antigone997 Words   |  4 PagesCreon as the Tragic Hero of Sophocles Antigone   Ã‚  Ã‚  Ã‚   Who is the true tragic hero in Sophocles Antigone?   This question has been the subject of a great debate for numerous years.   Equal arguments exist that portray Antigone as the tragic heroine in the play and Creon as the tragic hero.   Aristotle, in his study of Greek drama entitled Poetics, provided the framework that determines the tragic hero of a work.   Though Antigone definitely possesses the characteristics and qualities thatRead More Creon is the Tragic Hero in Sophocles Antigone Essay627 Words   |  3 Pages Creon is the Tragic Hero of Antigone nbsp; When the title of a play is a characters name, it is normally assumed that the character is the protagonist of the play. In Sophocles Antigone, most people probably believe Antigone to be the tragic heroine, even after they have finished watching the play. It may be argued, however, that Creon, not Antigone, is the tragic character. When we examine the nature and concept of the Greek Tragedy and what it means to be a tragic character, it becomesRead More Creon As Tragic Hero of Sophocles’ Antigone Essay836 Words   |  4 PagesCreon As Tragic Hero of Sophocles’ Antigone Since the play’s inception, there has always existed a contention concerning the true hero of Sophocles’ Antigone. It is a widely held belief that Antigone must be the main character simply because she and the drama share name. This is, of course, a very logical assumption. Certainly Sophocles must have at least meant her to be viewed as the protagonist, else he would not have given her the play’s title. Analytically speaking, however, Creon doesRead MoreEssay on Creon As The Tragic Hero Of Antigone by Sophocles781 Words   |  4 PagesCreon As The Tragic Hero Of Antigone by Sophocles Greek tragedy would not be complete with out a tragic hero. Sophocles wrote Antigone with a specific character in mind for this part. Based on Aristotle’s definition, Creon is the tragic hero of Antigone. Creon fits Aristotle’s tragic hero traits as a significant person who is faced with difficult decisions. Creon is significant because he is king. This makes him both renowned and prosperous. Creon is not completely good nor completely bad;Read MoreEssay on Creon The Tragic Hero of Sophocles Antigone723 Words   |  3 PagesCreon The Tragic Hero of Sophocles Antigone Every Greek tragedy must have a tragic hero. In Sophocle’s play, Antigone, the most tragic hero is Creon. He is an essentially good man of high position who takes pride in his role as king. He possesses the tragic flaws of excessive pride and an oversized ego. This causes the tragic reversal that leads to his emotional ruin and eventual remorse and repentance. As King of Thebes, Creon is forced to make difficult decisions. As a new ruler, he feelsRead MoreEssay about The Tragic Hero Creon in Antigone by Sophocles818 Words   |  4 PagesIn the play, Antigone by Sophocles, at first glance readers assume that Antigone is the tragic hero. However, this is not the case. Although Antigone does display some characteristics of a tragic hero, I believe that Creon is the true tragic hero. For many readers, it may be a challenge to see Creon as the tragic hero; however, when you take a second look at the play, you can see that Creon displays every quality of a tragic hero. Creon’s power and pride as well as going against the gods all leadRead More Creon as the Ideal Tragic Hero of Sophocles Antigone Essay1908 Words   |  8 PagesCreon as the Ideal Tragic Hero of Antigone Tragedy always involves human suffering, but not everyone who suffers is a Tragic Hero. According to Aristotle, there are five basic criteria that must be met for a character to be considered a Tragic Hero. Aristotle’s ideas about tragedy were recorded in his book of literacy theory titled Poetics. In it he has a great deal to say about the structure, purpose and intended effect of tragedy. His ideas have been adopted, disputed, expanded, and discussedRead MoreEssay about Creon Defines the Tragic Hero in Sophocles Antigone762 Words   |  4 PagesAntigone - Creon Defines the Tragic Hero   Ã‚   Antigone, written by Sophocles is a tale of a tragic hero who suffers with the recognition and realization of his tragic flaw. Although this short story is titled after Antigone, Creon is the main character and he provides the moral significance in the play. First, Creon withholds the respect of his citizens but it is clear to them he is not perfect through his pride (tragic flaw). Secondly, his radical reversal of fortune is made clear afterRead MoreEssay about The True Tragic Hero of Creon in Sophocles Antigone1621 Words   |  7 PagesThe True Tragic Hero of Creon in Sophocles Antigone There has always been a great debate over who is the true tragic hero in Sophocles Antigone. Many scholars would stake claim to Antigone possessing all the necessary characteristics of a true tragic hero, but many others would argue that Creon holds many qualities as well. It is hard to discount Antigone as a tragic hero, because in fact, the play bears her name, but from careful reading, Creon meets Aristotles criteria exactly and fits